View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1730_low_2 (Length: 326)
Name: NF1730_low_2
Description: NF1730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1730_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 14 - 310
Target Start/End: Complemental strand, 31009502 - 31009206
Alignment:
| Q |
14 |
cacaatcttccaaaatggccacttgttgcatagcctaaatcaccaaaagaatttattttggggaaccctacgacagattcaagcctacgacgagtgtata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31009502 |
cacaatcttccaaaatggccacttgttgcatagcctaaatcaccaaaagaatttattttggggaaccctacgacggattcaagcctacgacgagtgtata |
31009403 |
T |
 |
| Q |
114 |
taaggagcatcatgcaatggtaaatgagaaatgaaacagagaaaagcataagcaaccccataatccaacctgttttcgtgaaagtataagggagaccaag |
213 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31009402 |
taaggagcatcatgcagtggtaaatgagaaatgaaacagagaaaagcataagcaaccccatgatccaacctgttttcgtgaaagtataagggagaccaag |
31009303 |
T |
 |
| Q |
214 |
aacacctgcacctacaattgcaatgaagaggtttgcaaaggttttggattttgaggacagagggggttggtcagaaagaagaggggtgtgtagttgt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31009302 |
aacacctgcacctacaattgcaatgaagaggtttgcaaaggttttggattttgaggacagagggggttggtcagaaagaagaggggtgtgtagttgt |
31009206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University