View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1731-Insertion-11 (Length: 112)
Name: NF1731-Insertion-11
Description: NF1731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1731-Insertion-11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 8 - 112
Target Start/End: Original strand, 5062150 - 5062254
Alignment:
| Q |
8 |
ccatagacaaggaatagttattaaaacatgtactaggcttgatagcactgacatgctactcttaactagtgacaaaattaagttgtcaattttccaaact |
107 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5062150 |
ccatagacatggaatagttactaaaacatgtactaggcttgatagcactgacatgctactcttaactagtgacaaaattaagttgtcaattttccaaact |
5062249 |
T |
|
| Q |
108 |
tacaa |
112 |
Q |
| |
|
||||| |
|
|
| T |
5062250 |
tacaa |
5062254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University