View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17310_low_3 (Length: 355)
Name: NF17310_low_3
Description: NF17310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17310_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 25 - 246
Target Start/End: Original strand, 14457571 - 14457792
Alignment:
| Q |
25 |
tgtttagggctaaaccccaaaccctaacaaatatcaaattatcaataaatgattctattgttcaaaatcatttttgaggatttaatggatctgaatccta |
124 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14457571 |
tgtttagggctaaaccctaaaccctaacaaatatctaattatcaataaatgattctattgttcaaaatcaattttgaggatttaatggatctgaatccta |
14457670 |
T |
|
| Q |
125 |
tagaggtcacaccttgcagggtcagtatggatggatttgaattggatatgagtttagaatttatctctcttatatcttacagctgagtagtagaatttta |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14457671 |
tagaggtcacaccttgcagggtcagtatggatggatttgaattggatatgagtttagaatttatctctcttatatcttacagctgagtagtagaatttta |
14457770 |
T |
|
| Q |
225 |
cagtgcagttaaactacaacat |
246 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
14457771 |
cagtgcagttaaactacaacat |
14457792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 251 - 340
Target Start/End: Original strand, 14466638 - 14466726
Alignment:
| Q |
251 |
ataaatatacaatcctaaaaaacatttgtaatcatgataataaaaagaaaatcaaactacaacattggcttttcatcagtttgttgtgtg |
340 |
Q |
| |
|
||||||| |||||||| |||||||| |||||||||||| ||||||||||||||||||| |||||||||| ||||||||| |||||||||| |
|
|
| T |
14466638 |
ataaatacacaatccttaaaaacatctgtaatcatgatgataaaaagaaaatcaaactgcaacattggc-tttcatcagcttgttgtgtg |
14466726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 287 - 340
Target Start/End: Original strand, 14457799 - 14457852
Alignment:
| Q |
287 |
ataataaaaagaaaatcaaactacaacattggcttttcatcagtttgttgtgtg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
14457799 |
ataataaaaagaaaatcaaactacaacattggctttccatcagcttgttgtgtg |
14457852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University