View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17310_low_4 (Length: 300)
Name: NF17310_low_4
Description: NF17310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17310_low_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 11681952 - 11681653
Alignment:
| Q |
1 |
gtcgaaaacaaacacttggaattagaggctaaacacaatgttgccacatgtaaccaagaatcatttacattcaccaccaccaacatacttctatggaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11681952 |
gtcgaaaacaaacacttggaattagaggctaaacacaatgttgccacatgcaaccaagaatcatttacattcaccaccaccaacatacttttatggaaat |
11681853 |
T |
 |
| Q |
101 |
ttattttcaggcttgttatcgcttcaatgagtatcaacacagctttcaaatatcacaattgtccagctcttagccaccaccaataaggtgttatctgcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
11681852 |
ttattttcaggcttgttatcgcttcaatgagtatcaacacagctttcaaatatcacaattgtccagctcttagcccccaccaataaggtgtcatctgcaa |
11681753 |
T |
 |
| Q |
201 |
attgtagatgcgaaacattgaccgaacattataagcagtgaacaattcagcttctaccataacattcattaatctcattgtttttgaccaattaaaagag |
300 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11681752 |
attgtagatgcgaaacattgacctaacattataagcggtgaacaattcagcttctaccataacattcattaatctcattgtttttgaccaattaaaagag |
11681653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University