View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17310_low_9 (Length: 238)
Name: NF17310_low_9
Description: NF17310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17310_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 44243525 - 44243315
Alignment:
| Q |
18 |
acccacaccactatttttgaagtattgttcagtttggactttgtgtaaactctcactaatttgcctttatnnnnnnnnnnnnn----ctactagtttttg |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44243525 |
acccacgccactatttttgaagtattgttcagtttggactttgtgtaaactctcactaatttgcctttataaaaaaaaaaaaaaaaactactagtttttg |
44243426 |
T |
 |
| Q |
114 |
ttgtagttatgtaaagtatgagtgtctttttaacaagtatgagtattgtttattaactactttagtctcaactttcaaataatgtaggattttttggtgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44243425 |
ttgtagttatgtaaagtatgagtgtctttttaacaagtatgagtgttgtttattaactactttagtctgaactttcaaataatgtaggattttttggtgt |
44243326 |
T |
 |
| Q |
214 |
accagaataat |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
44243325 |
accagaataat |
44243315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University