View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17313_low_3 (Length: 268)
Name: NF17313_low_3
Description: NF17313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17313_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 25989054 - 25988847
Alignment:
| Q |
15 |
cacagacacaaacaccgaacatcgccaataataatccgagaaagtaaaaagattgaatgcaactccgatgaatgtcaaaacccagata---cttcgatct |
111 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25989054 |
cacagacacaaacaccgaacatcaccaataataatccgagaaagtaaaaagattgaatgtaactccgatgaatgtcaaaacccagatatgtcttcgatct |
25988955 |
T |
|
| Q |
112 |
gaagtgtcgatactacataggttacaaacatctattcaaatttatgactaggaaacatctttccctatcatttttcaagtgatccataccaaaagatatc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
25988954 |
gaagtgtcgatactacataggttacaaacatctattcaaatttatgactaggaaacatctttccctatcattttttaagtgatccataccaaaagacatc |
25988855 |
T |
|
| Q |
212 |
atataact |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
25988854 |
atataact |
25988847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University