View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17313_low_4 (Length: 237)
Name: NF17313_low_4
Description: NF17313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17313_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 9 - 223
Target Start/End: Complemental strand, 8326313 - 8326095
Alignment:
| Q |
9 |
tgtaatgaaaatatctcaaatcatcggtgaaattagttaaaaatgctttggtgaaaatgcagtgaattcgtggattgggtggctatcta-gtgcatcctc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
8326313 |
tgtaatgaaaatatctcaaatcatcggtgaagttagttaaaaatgctttggtgaaaatgtagtgaattcgaggattgggtggctatctatgtgcatcctc |
8326214 |
T |
 |
| Q |
108 |
ttttcttaaaaaataataatatctcgaatgttatacaaaatggaaccctgttattatggat---aaaaatgtagtgaattcgaggattgaaaatgaaaca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8326213 |
ttttcttaaaaaataataatatctcgaatgttatacaaaatggaaccctgttattatggatataaaaaatgtagtgaattcgaggattgaaaatgaaaca |
8326114 |
T |
 |
| Q |
205 |
catcatgggcatcactttg |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8326113 |
catcatgggcatcactttg |
8326095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University