View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17314_low_9 (Length: 294)
Name: NF17314_low_9
Description: NF17314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17314_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 17 - 278
Target Start/End: Complemental strand, 36522828 - 36522567
Alignment:
| Q |
17 |
ctgtgtttttcatagcatgatgatgatgagttgccatagaaggtgactttgagcttgttttccacataggtgctggtgtattgtacccacttttctttcc |
116 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36522828 |
ctgtctttttcatagcatggtgatgatgagttgccatagaaggtgactttgagcttgttttccacataggtgctggtgtattgtacccacttttctttcc |
36522729 |
T |
|
| Q |
117 |
catcaaaatggctctcttaaatctatatcttcttgaaaagggtgatgaagaagaagtggaggaacaacctcgttttctgatcttgttatgtttctgttta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36522728 |
catcaaaatggctctcttaaatctatatcttcttgaaaagggtgatgaagaagaagtggaggaacaacctcgttttctgatcttgttatgtttctgttta |
36522629 |
T |
|
| Q |
217 |
agatgttttgtctgacacgaggacataatggaaattgtgaaacaaaaaatcagtgagcaaat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36522628 |
agatgttttgtctgacacgaggacataatggaaattgtgaaacaaaaaatcagtgagcaaat |
36522567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University