View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17315_high_17 (Length: 350)
Name: NF17315_high_17
Description: NF17315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17315_high_17 |
 |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0102 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 14 - 350
Target Start/End: Original strand, 33993 - 34331
Alignment:
| Q |
14 |
aaatccacaaagctatatttgaaagacctgctggatttctacctagtcagacggagattgcagctactaaggaaaataagatttagcagatcaatgtcat |
113 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33993 |
aaatccacaaaactatatttgaaagacctgctgggtttctacctagttagacggagattgcagctactaaggaaaataagatttagcagatcaatgtcat |
34092 |
T |
 |
| Q |
114 |
agggctcaagagtagtaaagcaattgatagtgctgtgaaggaga--gagttagttctgaatccaaagcgcatagaagaaaaagttatctcaaaagaggag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||| || ||| |||||||||| ||||||||||||| |
|
|
| T |
34093 |
agggctcaagagtagtaaagcaattgatagtgctgagaaggagagagagttagttgtgaatccaaagcccacagaggaaaaagttagctcaaaagaggag |
34192 |
T |
 |
| Q |
212 |
atgtagaccgctgcaacacctagttcagaagaagtagatatatagaccgctgtatctccaacctcaacacaaacaaagatgtagaccgttgcatctctaa |
311 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34193 |
atgtagaccgctgtaactcctagttcagaagaagcagatatatagactgctgtatcaacaacctcaacacaaacaaagatgtagaccgctgcatctctaa |
34292 |
T |
 |
| Q |
312 |
agttaaaagagaattctataagtatcaaagctacaactc |
350 |
Q |
| |
|
||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34293 |
agtcaaaagagaattctatcagtatcaaagctacaactc |
34331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University