View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17315_high_31 (Length: 228)
Name: NF17315_high_31
Description: NF17315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17315_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 209
Target Start/End: Complemental strand, 25952352 - 25952156
Alignment:
| Q |
13 |
agcaaaggggaagatatgggactagcctatttatatagaagtagggattttgtcaaatggacccgagccaaacacccgattcactcggctaaaaccacag |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25952352 |
agcaaaagggaagatatgggactagcctatttatatagaagtagggattttgtcaaatggacccgagccaaacacccgattcactcggctaaaaccactg |
25952253 |
T |
|
| Q |
113 |
gtatgtgggagtgtccggatttttacccggtttctttggaagggaaaaacgggttagacgcatcgacgataggtaatagtgttaaacatgtgctaaa |
209 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25952252 |
ggatgtgggagtgtccggatttttacccggtttctttggaagggaaaaacgggttagacgcatcgacgataggtaatagtgttaaacatgtgctaaa |
25952156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 37 - 146
Target Start/End: Original strand, 42590775 - 42590884
Alignment:
| Q |
37 |
gcctatttatatagaagtagggattttgtcaaatggacccgagccaaacacccgattcactcggctaaaaccacaggtatgtgggagtgtccggattttt |
136 |
Q |
| |
|
||||| || ||||| |||||||||||||| |||||| || |||||||||||||| || || | || || ||||||||||||||||| ||||||| |
|
|
| T |
42590775 |
gcctacttgtataggagtagggattttgtgaaatgggttcgggccaaacacccgatccattcaaaaactactacgggtatgtgggagtgtcctgattttt |
42590874 |
T |
|
| Q |
137 |
acccggtttc |
146 |
Q |
| |
|
|||||||||| |
|
|
| T |
42590875 |
acccggtttc |
42590884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University