View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17315_low_15 (Length: 362)
Name: NF17315_low_15
Description: NF17315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17315_low_15 |
 |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0102 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 21 - 325
Target Start/End: Complemental strand, 34614 - 34320
Alignment:
| Q |
21 |
agtgaagctaaatgggtccttcatctttcctggtatcttgtgttggatcaacatgctgctttcagctgtcattgctaacgtcttaaagtctcccaacctt |
120 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
34614 |
agtgaagctacatgggtccttcatctttcctggtatcttgtgttggatcaacatgctgctttcagctgtcattgctaatgtcttaaagtcgcccaacctt |
34515 |
T |
 |
| Q |
121 |
cttctcttagtgatcacatccttcagaaacttagcataatttagcatttgttgtagatcttctagcaacgaaatgttgatgttgagttacttcaagacct |
220 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34514 |
cttctcttagtgatcatatccttcagaaacttagcat----------ttgttgtagatcttctagcaacgaaatgttgatgttgagttacttcaagacct |
34425 |
T |
 |
| Q |
221 |
ccaagaacttcttgtactgcttctccggtggagctttcaccaacctttgaggaaaaggtggatcaagtgacttggtgcagtacctgtagtctggtgttgt |
320 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| | | ||||||||||| ||||| |
|
|
| T |
34424 |
ccaagaacttcttgtactgcttctccagtggagctttcaccaacctttgaggaaaaggtggatcaagagacttggtgtactgactgtagtctggagttgt |
34325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University