View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17315_low_28 (Length: 251)
Name: NF17315_low_28
Description: NF17315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17315_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 7 - 244
Target Start/End: Complemental strand, 10760946 - 10760709
Alignment:
| Q |
7 |
gaaataagctcaggccttgctatggagggaaatattttcttgccttcaacttgaatagagactttaacataagcttgactttgggattggacttgtgtta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10760946 |
gaaataagctcaggccttgctatggagggaaatattttcttgccttcaacttgaatagagactttaacataagcttggctttgggattggacttgtgtta |
10760847 |
T |
 |
| Q |
107 |
aaatgctgataggtgttttgcatcttataatctcttgagcaactgatagaacatcagatttaaataagaaattgggcttcgtgaaatcccaaccatatac |
206 |
Q |
| |
|
| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10760846 |
atatgctgataggtgttttgcatcttattatctcttgagcaactgatagaacatcagatttaaataagaaattcggcttcgtgaaatcccaaccatatac |
10760747 |
T |
 |
| Q |
207 |
acattggaatctagagggttcacctaatttctctggtc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760746 |
acattggaatctagagggttcacctaatttctctggtc |
10760709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University