View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17315_low_29 (Length: 248)

Name: NF17315_low_29
Description: NF17315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17315_low_29
NF17315_low_29
[»] chr8 (1 HSPs)
chr8 (71-230)||(2937326-2937485)


Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 71 - 230
Target Start/End: Complemental strand, 2937485 - 2937326
Alignment:
71 cgatatcttttgattcattaaagaacgtctcaaaaacatttatcataatttcttttagaatttcataagatttaacaaaatttaannnnnnngtgatata 170  Q
    |||||||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||       || |||||    
2937485 cgatatctcttgattcattaaagaatgtcccaaaaacatttatcataatttcttttagaatttcataagatttaacaaaatttaatttttttgttatata 2937386  T
171 gacattttaccaaaatcagtttttatttcacttttgacaataatattaaatattttgaga 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2937385 gacattttaccaaaatcagtttttatttcacttttgacaataatattaaatattttgaga 2937326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University