View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17315_low_29 (Length: 248)
Name: NF17315_low_29
Description: NF17315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17315_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 71 - 230
Target Start/End: Complemental strand, 2937485 - 2937326
Alignment:
| Q |
71 |
cgatatcttttgattcattaaagaacgtctcaaaaacatttatcataatttcttttagaatttcataagatttaacaaaatttaannnnnnngtgatata |
170 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
2937485 |
cgatatctcttgattcattaaagaatgtcccaaaaacatttatcataatttcttttagaatttcataagatttaacaaaatttaatttttttgttatata |
2937386 |
T |
|
| Q |
171 |
gacattttaccaaaatcagtttttatttcacttttgacaataatattaaatattttgaga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2937385 |
gacattttaccaaaatcagtttttatttcacttttgacaataatattaaatattttgaga |
2937326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University