View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17316_high_15 (Length: 250)
Name: NF17316_high_15
Description: NF17316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17316_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 30836877 - 30836953
Alignment:
| Q |
1 |
gttagatgagactatttgactgtaaatttggcctcatttatacttgattgatttggttta----caatgacttgacc |
73 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30836877 |
gttagatgagactatttgactataaatttggcctcatttatacttgattgatttggtttaattacaatgacttgacc |
30836953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University