View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17316_high_19 (Length: 235)
Name: NF17316_high_19
Description: NF17316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17316_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 39365357 - 39365584
Alignment:
| Q |
1 |
tctgatcagcaaaaccattcaccgtcaccttttgcaacttcatgtctatttcaatgtcatccacacctttaaatacatacaaaaaatcatatgatcacta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39365357 |
tctgatcagcaaaaccattcaccgtcaccttttgcaacttcatgtctatttcaatgtcatccacacctttaaataaatacaaaaaatcatatgatcacta |
39365456 |
T |
 |
| Q |
101 |
ttaccttatgcttggaaggaagatgaaaatgtacaaaat---------aaggtacctttcattttctgaagtgcagttttcactttgttttcacatccag |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365457 |
ttaccttatgcttggaaggaagatgaaaatgtacaaaataagcaaacgaaggtacctttcattttctgaagtgcagttttcactttgttttcacatccag |
39365556 |
T |
 |
| Q |
192 |
ggcaatccatgtgcaccctcatctctgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
39365557 |
ggcaatccatgtgcaccctcatctctgt |
39365584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University