View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17316_high_20 (Length: 230)
Name: NF17316_high_20
Description: NF17316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17316_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 9 - 224
Target Start/End: Original strand, 45438084 - 45438299
Alignment:
| Q |
9 |
gaagaatatctcatcattgaacttcattcagtactagggaataggtaattaaattcaatccttcttttttaagtatgatttaccagagtttacaacactc |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45438084 |
gaagaaaatctcatcattgaacttcattcagtactagggaataggtaattaaattcaatccttcttttttaagtatgatttaccagagtttacaacactc |
45438183 |
T |
 |
| Q |
109 |
acacacgacacaccaaccacttgcgttagactctagcgtattttttaattgttatgtggttgttggatcattctttttatttttcaaaccttattgacat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45438184 |
acacacgacacaccaaccacttgcgttagactctggcgtattttttaattgttatgtggttgttggatcattctttttatttttcaaaccttattgacat |
45438283 |
T |
 |
| Q |
209 |
gcatatgatgtgtttt |
224 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45438284 |
gcatatgatgtgtttt |
45438299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University