View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17316_low_20 (Length: 237)
Name: NF17316_low_20
Description: NF17316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17316_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 4744944 - 4744724
Alignment:
| Q |
1 |
ccccaacctttaccccaagaattcttaatcaaccaatatttagttccatcttcacttacaccgtaaccaactgcagcaactgcatggttgaatggttgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| | || ||||| |
|
|
| T |
4744944 |
ccccaacctttaccccaagaattcttaatcaaccaatacttagttccatcttcacttacaccgtaaccaactgcagtaactgcatggttcattgattgtc |
4744845 |
T |
 |
| Q |
101 |
cacatggtcctgaataaacccctcccatgtaatgtctaaaatcatcaccgacatcaatgccaactgatatcggctgttgtgctactgcttgtagtagctg |
200 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| ||| |||||||| || |||||||||||||||| || ||||||||||| ||||||||||| || |
|
|
| T |
4744844 |
cacatgttcctgaataaacatctcccatgtaatgttgaaattcatcaccaacttcaatgccaactgatactggttgttgtgctacagcttgtagtagttg |
4744745 |
T |
 |
| Q |
201 |
ttgttcatcattggcaggtac |
221 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
4744744 |
ttgttcgtcattggcaggtac |
4744724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 12 - 89
Target Start/End: Complemental strand, 4736422 - 4736345
Alignment:
| Q |
12 |
accccaagaattcttaatcaaccaatatttagttccatcttcacttacaccgtaaccaactgcagcaactgcatggtt |
89 |
Q |
| |
|
||||||||||||||||||||||||||| || | || |||||||||| || ||||||| | || |||||||||||| |
|
|
| T |
4736422 |
accccaagaattcttaatcaaccaatacttcttccctgcttcacttaccccataaccaattatagtaactgcatggtt |
4736345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University