View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17317_low_11 (Length: 281)
Name: NF17317_low_11
Description: NF17317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17317_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 265
Target Start/End: Complemental strand, 53090957 - 53090694
Alignment:
| Q |
13 |
aatatccaagaccaatagcatatccacccaccgctttggttctctttctgagatagtataacagaattgttctagtaaagtggacgcgaagaaacgaagc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53090957 |
aatatccaagaccaatagcatatccacccaccgctttggctctctttctgagatagtataacagaattgttctagtgaagtggacgcgaagaaacgaagc |
53090858 |
T |
 |
| Q |
113 |
ttccaatcttcataccatatattatgccaattgtctcctttaatattgtccatttctactacacattactaactactacttataactaacctaattatct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53090857 |
ttccaatcttcataccatatattatgccaattgtctcctttaatattgtccatttctactacacattactaactactacttataaccaacctaattatct |
53090758 |
T |
 |
| Q |
213 |
cattcttctctc-----------tctaacacaaagatgaataagaataaagagggtgtgatgct |
265 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53090757 |
cattcttctctctatctctatcttctaacacaaagatgaataagaataaagagggtgtgatgct |
53090694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University