View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17317_low_5 (Length: 347)
Name: NF17317_low_5
Description: NF17317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17317_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 328
Target Start/End: Original strand, 47639321 - 47639648
Alignment:
| Q |
1 |
tctactcagccaaaacttacctctccgtcttcaggtatcaacataacttatgtaacaataattttgttatcagggttttaatttatgtaacaccgacagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47639321 |
tctactcagccaaaacttacctctccgtcttcaggtatcaacataacttatgtaacaataattttgttatcagggttttaatttatgtaacaccgacagt |
47639420 |
T |
|
| Q |
101 |
ttagatgacgtgtattgtgtccgatattagtctgacacaacaagtgtatttatatatcatattaacgtaatttattgttgatattgatttacacatgtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47639421 |
ttagatgacgtgtattgtgtccgatattagtctgacacaacaagtgtatttatatatcatattaacgtaatttattgttgatattgatttacacatgtca |
47639520 |
T |
|
| Q |
201 |
gtgttgtgtttaagtctgtgttagtacttcatagattttaactctgcatctgggatgtcttaaagtgctggtcttgtgtaggaaagagcactgtgccttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47639521 |
gtgttgtgtttaagtctgtgttagtacttcatagattttaactctgcatctgggatgtcttaaagtgctggtcttgtgtaggaaagagcactgtgccttt |
47639620 |
T |
|
| Q |
301 |
aatcattgcgatttttgttccaactgtt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
47639621 |
aatcattgcgatttttgttccaactgtt |
47639648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University