View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17317_low_8 (Length: 314)
Name: NF17317_low_8
Description: NF17317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17317_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 17 - 295
Target Start/End: Original strand, 22958675 - 22958953
Alignment:
| Q |
17 |
agcataggagctgaaacattcacataatgaattccatgagccaccttataatcaaccttgtcacactccttccctgaaccatcatcatatcttttataac |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22958675 |
agcataggagctgaaacatgcacataatgaattccatgagccaccttataatcaaccttgtcacactccttccctgaaccatcatcatatcttttataac |
22958774 |
T |
|
| Q |
117 |
cggaccgggtcaatccccgatccaaaccctcaatacgatccataaaatacacaactggtttcacacacgaatcttgactaacgggtcgggtattaaaagt |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22958775 |
cggaccgggtcaatccccgatctaaaccctcaatccgatccataaaatacacaaccggtttcacacacgaatcttgactaacgggtcgggtattaaaagt |
22958874 |
T |
|
| Q |
217 |
aaacggggcatcactccaagtcctccacgttttaaatgtttgggaaaccatttcaagatatttagctgttggtaaatag |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22958875 |
aaacggggcatcactccaagtcctccacgttttaaatgtttgggaaaccatttcaagatatttagctgttggtaaatag |
22958953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University