View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17318_high_35 (Length: 303)
Name: NF17318_high_35
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17318_high_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 288
Target Start/End: Complemental strand, 7769244 - 7768978
Alignment:
| Q |
11 |
atgaatgtgagaaatgaaatccatgtaatttcgatacgaaaggttaacgtgtcacatcataatttctaacgatggaaggtaatagagagattattttgaa |
110 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7769244 |
atgaatgtgagaaatgaactccatgtaatttcgatacgaaaggttaacgt----catcataatttctaacgatgaaaggtaatagagagattattttgaa |
7769149 |
T |
|
| Q |
111 |
taacattttacaattttagacagttttgccaattcagaaaattcaaaataggtgaatgactttagtattgtatttttccccaatcaagagattaatttca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7769148 |
taacattttacaattttagacagttttgccaattcataaaattcaaaataggtgaatgactttagtattgaatttttccccaatcaagagattaatttca |
7769049 |
T |
|
| Q |
211 |
ttgtgaatttccttgtaagaatataggtaaattctaccatgtcttgaagtacatagtagattcacaatagaaaaatat |
288 |
Q |
| |
|
|| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7769048 |
ttatgaatttccttgta-------aggtaaattctaccatgtcttgaagtacatagtagattcacaatagaaaaatat |
7768978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University