View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17318_high_50 (Length: 253)
Name: NF17318_high_50
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17318_high_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 78 - 197
Target Start/End: Complemental strand, 33527305 - 33527186
Alignment:
| Q |
78 |
aatgaaatagtagttgttgactcaaatgaggttatattagtatgaaagtggaaaattatataaggggattgttagttaaaagtttttaactgtattaaag |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33527305 |
aatgaaatagtagttgttgactcaaatgaggttatattagtatgaaagtggaaaattatataaggggattgttagttaaaagtttttaactgtattaaag |
33527206 |
T |
 |
| Q |
178 |
gataagataatgttttggag |
197 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33527205 |
gataagataatgttttggag |
33527186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University