View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17318_high_62 (Length: 216)
Name: NF17318_high_62
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17318_high_62 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 14 - 201
Target Start/End: Complemental strand, 48156692 - 48156505
Alignment:
| Q |
14 |
gcaaagggtgtaggaagagactttagcaagtttatcagaacagataacacatgtggaccagagccttccattgtggaaaggctggagaaaaaggttgagg |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48156692 |
gcaaagagtgtaggaagagactttagcaagttcatcagaacagataacacatgtggaccagagccttccattgtggaaaggctggagaaaaaggttgagg |
48156593 |
T |
 |
| Q |
114 |
aaggagagaaaaccattgtgagggaagttgaagagttagaagaggaggtggagaaggatttggagaaggttggcaaaacagaaatgac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48156592 |
aaggagagaaaaccattgtgagggaagttgaagagttagaagaggaggtggagaaggatttggagaaggttggcaaaacagaaatgac |
48156505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University