View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17318_low_24 (Length: 374)
Name: NF17318_low_24
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17318_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 9e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 159 - 336
Target Start/End: Complemental strand, 33526983 - 33526806
Alignment:
| Q |
159 |
caatgtttagtgcagttgagttcccgcccccatagattgtttgcaaactagcggttaatgcgaccactgttttgtgatttgcagtcggttagtcaaatac |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33526983 |
caatgtttagtgcagttgagttcccgcccccatagattgtttgcaaactagcggttaatgcgaccactgttttgtgatttgcagtcggttagtcaaatac |
33526884 |
T |
 |
| Q |
259 |
aaacttaccaaaaataccccactctagtatgaataggatcaagttaatatattatttttctacccttacttaatacaa |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||| |
|
|
| T |
33526883 |
aaacttaccaaaaataccccactctagtatgaataggatcaagttagtatattaattttctacccttgcttaatacaa |
33526806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 49 - 107
Target Start/End: Complemental strand, 33527075 - 33527017
Alignment:
| Q |
49 |
caatgggcagtttagatggtattgcttcatgttgtgccacttaatagtaaagttagact |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33527075 |
caatgggcagtttagatggtattgcttcatgttgtgccacttaatagtaaagttagact |
33527017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University