View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17318_low_33 (Length: 333)
Name: NF17318_low_33
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17318_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 45373956 - 45374267
Alignment:
| Q |
1 |
agaggaactcggttatgatgcatggagaggttatggttttgtgtgaagtcgagggtgattgttgggaagggctgagaagctgatagggttgaggttgcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45373956 |
agaggaactcggttatgatgcatggagaggttatggttttgtgtgaagtcgagggtgattgttgggaagggctgagaagctgatagggttgaggttgcca |
45374055 |
T |
 |
| Q |
101 |
ttgttgcatagggaaatgaattagataaatatcctgttgctgattcctttcttagtgttgatgaggttgaacttgatagcagcattgctgcagctgctga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45374056 |
ttgttgcatagggaaatgaattagataaataacctgttgctgattcctttcttagtgttgatgaggttgaacttgatagcagcattgctgcagctgctga |
45374155 |
T |
 |
| Q |
201 |
tgttgtgtgtgctatggcagttgcagctggtgggagtgggtgattgtggttgccttcatatgttgttattagtattgtcttgtcttctgcacatctttgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45374156 |
tgttgtgtgtgctatggcagttgcagctggtgggagtgggtgattgtggttgccttcatatgttgttattagtattgtcttgtcttctgcacatctttgg |
45374255 |
T |
 |
| Q |
301 |
acctgttcaaga |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45374256 |
acctgttcaaga |
45374267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 253 - 306
Target Start/End: Complemental strand, 37054065 - 37054012
Alignment:
| Q |
253 |
ccttcatatgttgttattagtattgtcttgtcttctgcacatctttggacctgt |
306 |
Q |
| |
|
|||||||||||||| || |||||||| |||||||| ||||| ||||| |||||| |
|
|
| T |
37054065 |
ccttcatatgttgtgataagtattgttttgtcttcagcacacctttgtacctgt |
37054012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University