View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17318_low_45 (Length: 274)
Name: NF17318_low_45
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17318_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 264
Target Start/End: Complemental strand, 7499472 - 7499226
Alignment:
| Q |
18 |
aaaaggaacgagaagtaacttcggaaagaaacgaaccttctggtgtaccaaaagatgccctagatggtgaccaatcccctgaacagatagaagattcaaa |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499472 |
aaaaggaatgagaagtaacttcggaaagaaacgaaccttctggtgtaccaaaagatgccctagatggtgaccaatcccctgaacagatagaagattcaaa |
7499373 |
T |
|
| Q |
118 |
aacaaaagctcacatctagaagacctcattattggcaacaaggtgattctagaaagacaagatcaacattaaggaatgtaacttctctagtgggactttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499372 |
aacaaaagctcacatctagaagacctcattattggcaacaaggtgattctagaaagacaagatcaacattaaggaatgtaacttctctagtgggactttt |
7499273 |
T |
|
| Q |
218 |
gtcaatgattgtaccagtcaaagtggatgaagctctaagtgatgatg |
264 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7499272 |
gtcaatgattgcaccagtcaaagtggatgaagctctaagtggtgatg |
7499226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University