View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17318_low_52 (Length: 255)
Name: NF17318_low_52
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17318_low_52 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 5e-37; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 17 - 119
Target Start/End: Complemental strand, 30966450 - 30966348
Alignment:
| Q |
17 |
tatacacataaatacagaaagatattctaatagtacttcaatgtatcaaaattgcaaacacatccaaatttagtcgttttggttcttgaatatgttttta |
116 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
30966450 |
tatacacattaatacagaaagatgttctaatagtaattcaatgtatcaaaattgcaaacacatccaactttagtcggttttgttcttgaatatgttttta |
30966351 |
T |
|
| Q |
117 |
gct |
119 |
Q |
| |
|
||| |
|
|
| T |
30966350 |
gct |
30966348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 9 - 109
Target Start/End: Complemental strand, 30957324 - 30957225
Alignment:
| Q |
9 |
tcgaagaatatacacataaatacagaaagatattctaatagtacttcaatgtatcaaaattgcaaacacatccaaatttagtcgttttggttcttgaata |
108 |
Q |
| |
|
||||| ||||||||||| |||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
30957324 |
tcgaataatatacacattaatacaaaaagttattctaatagtacttcaa-gtatcaaaattgcaaacacatccaagtttagtcggtttggttcttgaata |
30957226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 27 - 129
Target Start/End: Complemental strand, 30936148 - 30936046
Alignment:
| Q |
27 |
aatacagaaagatattctaatagtacttcaatgtatcaaaattgcaaacacatccaaatttagtcgttttggttcttgaatatgtttttagcttgtcaaa |
126 |
Q |
| |
|
|||||| ||| |||||||||| |||||| |||||||||| ||||||||||||||||||||||||| |||||||||| ||||||| ||||||| ||||| |
|
|
| T |
30936148 |
aatacacaaaaatattctaatcgtacttgaatgtatcaacattgcaaacacatccaaatttagtcagtttggttcttaaatatgtatttagctactcaaa |
30936049 |
T |
|
| Q |
127 |
tta |
129 |
Q |
| |
|
||| |
|
|
| T |
30936048 |
tta |
30936046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 170 - 254
Target Start/End: Complemental strand, 30935549 - 30935465
Alignment:
| Q |
170 |
caagtaaacatacatagaaatattgaaattctaatcagccnnnnnnnncctcaactctgcatcacagaggatgtgcaatgaccct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||| |
|
|
| T |
30935549 |
caagtaaacatacatagaaatattgaaattctaatcagcctttttttccttcaactctgcatcacagaggacttgcaatgaccct |
30935465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 168 - 209
Target Start/End: Complemental strand, 30965662 - 30965621
Alignment:
| Q |
168 |
cacaagtaaacatacatagaaatattgaaattctaatcagcc |
209 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
30965662 |
cacaagtaaacatacatagaaaaattggaattctaatcagcc |
30965621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University