View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17318_low_68 (Length: 208)
Name: NF17318_low_68
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17318_low_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 90 - 166
Target Start/End: Original strand, 13337659 - 13337735
Alignment:
| Q |
90 |
ctggtgtgagggaactgaactagttgagttcttgtttcagctggaaaataatttataatttataattataatctgaa |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13337659 |
ctggtgtgagggaactgaactagttgagttcttgtttcagctgaaaaataatttataatttataattataatctgaa |
13337735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 13337572 - 13337617
Alignment:
| Q |
1 |
tcatcttctgaaatttgtaagttcctttgaatttcagaacaaatat |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13337572 |
tcatcttctgaaatttgtaagttcctttgaatttcagaacaaatat |
13337617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University