View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17318_low_69 (Length: 206)
Name: NF17318_low_69
Description: NF17318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17318_low_69 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 191
Target Start/End: Original strand, 37088400 - 37088574
Alignment:
| Q |
17 |
aatattctgtcttgctttggtcacttgtacataagtgtgtcaattttggtctagttagcaatccctgtcagtcttttgaattgtattgtatagtattctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37088400 |
aatattctgtcttgctttggtcacttgtgcataagtgtgtcaattttggtctagttagcaatccctgtcagtcttttgaattgtattgtatagtattctt |
37088499 |
T |
 |
| Q |
117 |
ttggtataatggagaatcatatctgattttttctgactcttctatggcatctagaattgtatcttgcaactattt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37088500 |
ttggtataatggagaatcatatctgattttttctgactcttctatggcatctagaattgtatcttgcaactattt |
37088574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University