View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17319_high_1 (Length: 372)
Name: NF17319_high_1
Description: NF17319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17319_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 355; Significance: 0; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 1 - 359
Target Start/End: Original strand, 10559241 - 10559599
Alignment:
| Q |
1 |
gcgactgccgagattagtagggttcagaattggcagtggcttaagtatggagttgaacttgatggtgatggacttggagtgaaagtgagtaaagaactat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10559241 |
gcgactgccgagattagtagggttcagaattggcagtggcttaagtatggagttgaacttgatggtgatggacttggagtgaaagtgagtaaagaactat |
10559340 |
T |
 |
| Q |
101 |
ttggtagagttgttgaagaagagatggataggattgaaaaagaggttggaaaagataagttcacgaagggaatgtataaggatgcttgcaagattttcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10559341 |
ttggtagagttgttgaagaagagatggataggattgaaaaagaggttggaaaagataagttcaagaagggaatgtataaggatgcttgcaagattttcac |
10559440 |
T |
 |
| Q |
201 |
taggcaatgcacttcaccaacacttgatgattttctcactcttgatgcctataattatattgttgtagttcaccctgtggaactgtcaaagctttgaatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10559441 |
taggcaatgcacttcaccaacacttgatgattttctcactcttgatgcctataattatattgttgtagttcaccctgtggaactgtcaaagctttgaatt |
10559540 |
T |
 |
| Q |
301 |
ttgatttggttcatacttcattgtggttgatgatagtttattgttctaaattatgtcct |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10559541 |
ttgatttggttcatacttcattgtggttgatgatagtttattgttctaaattatgtcct |
10559599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 269 - 359
Target Start/End: Original strand, 10560482 - 10560578
Alignment:
| Q |
269 |
ttcaccctgtggaactgtcaaagctttgaattttgatttggttcatacttca------ttgtggttgatgatagtttattgttctaaattatgtcct |
359 |
Q |
| |
|
||||| ||||||||| |||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10560482 |
ttcactctgtggaacagtcaaagctttgaattatgatttggtttatacttcattatatttgtggttgatgatagtttattgttttaaattatgtcct |
10560578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University