View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17319_low_2 (Length: 282)
Name: NF17319_low_2
Description: NF17319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17319_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 53 - 266
Target Start/End: Complemental strand, 41968709 - 41968496
Alignment:
| Q |
53 |
atagttatttttaattgaaacagtaattttttccaactatagctagctagtggtcttttgactggaacagaatccaagcatttggtcaacagatttctac |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41968709 |
atagttatttttaattgaaacagtaattttttccaactatagctagctagtggtcttttgactggaacagaatccaagtatttggtcaacagatttctac |
41968610 |
T |
|
| Q |
153 |
ttgggggaacaaacgaaatccttcaaattaatttcttaattacaatttaattgaatcatgttaataaattagtattatttggagtaatatggagcacagc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41968609 |
ttgggggaacaaacgaaatccttcaaattaatttcttaattacaatttaattgaatcatgttaataaattagtattatttggagtaatatggagcacagc |
41968510 |
T |
|
| Q |
253 |
ttagtgttatattt |
266 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
41968509 |
ttagtcttatattt |
41968496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University