View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1731_high_48 (Length: 247)
Name: NF1731_high_48
Description: NF1731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1731_high_48 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 152 - 247
Target Start/End: Complemental strand, 21583412 - 21583317
Alignment:
| Q |
152 |
aattacgtaacattaaaaggaaaatcaatgtcattaatgacttattaaataaaaaattatgatgaacacagattgtctaaagtattcaagctgttt |
247 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21583412 |
aattacgcaacattaaaaggaaaatcaatgtcattaatgacttattaaataaaaaattatgatgaacacggattgtctaaagtattcaagctgttt |
21583317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University