View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1731_high_53 (Length: 238)
Name: NF1731_high_53
Description: NF1731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1731_high_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 73 - 221
Target Start/End: Original strand, 7582705 - 7582858
Alignment:
| Q |
73 |
tcataaatggatggtgtg----tatgcgatgcatgtaagcacttaaattgctcttaggaaattatctcatttgcctataccatgacaatggtcgttaaca |
168 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7582705 |
tcataaatggatggtgtgcatatatgcgatgcatgtaagcacttaaaatgctcttaggaaatgatctcatttgcctataccatgacaatggtcgttaaca |
7582804 |
T |
 |
| Q |
169 |
ttagactccatttaggtc-tttatgtagccgaatgtggaaaagcagcatcgtat |
221 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7582805 |
ttagactccatttaggtcttttatgtagccgaatgtggaaaagcagcatcgtat |
7582858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University