View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1731_low_17 (Length: 410)
Name: NF1731_low_17
Description: NF1731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1731_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 9e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 227 - 398
Target Start/End: Original strand, 50342459 - 50342630
Alignment:
| Q |
227 |
tttattaatttttctttggttgaataggtgattaggtcactaatttaacttgatatttgtttccaaactgtagttgagaatttattgaggcttgccccgg |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| || |
|
|
| T |
50342459 |
tttattaatttttctttggttgaataggtgattaggtcactaatttaacttgatatttgtttccaaactgtagttgagattttgttgaggcttgccctgg |
50342558 |
T |
 |
| Q |
327 |
ctagactagaattctctgcaacggttacggttaccatccaaattgggtcgtgacaaagttgattgtttataa |
398 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50342559 |
ctagactagaattctctgcaccggttacggttaccatccaaattgggtcgtgacaaagttgattgtttataa |
50342630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 178 - 230
Target Start/End: Original strand, 50342370 - 50342423
Alignment:
| Q |
178 |
aaccctgagaa-tgaaaaatgaggatctttgaaattatctgttatgtcttttta |
230 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50342370 |
aaccctgagaaatgaaaaatgaggatctttgaaattatctgttatgtcttttta |
50342423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University