View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1731_low_30 (Length: 336)
Name: NF1731_low_30
Description: NF1731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1731_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 78 - 326
Target Start/End: Original strand, 16193096 - 16193350
Alignment:
| Q |
78 |
aaataaataaatacttataagtttggtttctcgttagttagtagttttgacatgaaattttgttacattccaagggatataaggttggtttggtggttgc |
177 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16193096 |
aaataaataa-tacttataagtttggtttctcattagttagtagttttgacatgaaattttgttacattccatgggatataaggttggtttggtggttgc |
16193194 |
T |
|
| Q |
178 |
gtgcgcaagttaaaagggtagttagtga-------tatgaaggtcgggggtttgatccccactctcagcataatgctaaaattagtaatgatattaatat |
270 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16193195 |
gtgcgcaagttaaaagggtagttagtgatatgaactatgaaggccgggggtttgatccccactctcagcataatgctaaaattagtaataatattaatat |
16193294 |
T |
|
| Q |
271 |
tagccgtttcaactctctcaatcgtaacctaacatatgagcaattgctctcctatg |
326 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16193295 |
tagccgtttcaactctctaagtcgtaacctaacatatgagcaattgctctcctatg |
16193350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 51
Target Start/End: Original strand, 16193041 - 16193073
Alignment:
| Q |
19 |
gcaccaattaagatatgtggtaactatttttca |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16193041 |
gcaccaattaagatatgtggtaactatttttca |
16193073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University