View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1731_low_37 (Length: 303)
Name: NF1731_low_37
Description: NF1731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1731_low_37 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 16 - 303
Target Start/End: Complemental strand, 17351528 - 17351240
Alignment:
| Q |
16 |
atgaaaaagtgtgtcatggggtgtccatagaggtatattgtggaaggatcaagaagagagaaatttgtgttgctagattcgactaatcgaacaagagtat |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||| |
|
|
| T |
17351528 |
atgaaaaagtgtgtcatagggtgtccatagaggtatattgtggaaggatcaagaagagagaaatttgtgttactagattcgactaatcgaagacgagtat |
17351429 |
T |
 |
| Q |
116 |
agtattttaacaactcaaaatcagggtgagcacacatggtagatgtacatggtatgtcattgtatataatttatgataggacaatatatcattgtttgat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17351428 |
agtattttaacaactcaaaatcagggtgagcacacatggtagatgtaaatggtatgtcattgcatataatttatgataggacaatatatcatcgtttgat |
17351329 |
T |
 |
| Q |
216 |
ccatgtgatttatcccatctaatagaaaaaagttttggtttttgtatcttcatattatggatcc-tttgtttcatataagatcattctc |
303 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17351328 |
ccatgtgatttatctcatctaatagaaaaaagttttggtttttgtatcttcatattatggatccatttgtttcatataagatcattctc |
17351240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University