View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1731_low_47 (Length: 248)
Name: NF1731_low_47
Description: NF1731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1731_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 17351206 - 17350975
Alignment:
| Q |
1 |
tgtgggaagcagaagggtggtagaggtgaaatgatcatttttt-actatgttaatgtattgtgcctatagacacgagtacatataccactattcctgcat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||| || |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17351206 |
tgtgggaagcagaagggtggtagaggtgaaaggatcatttttttactatgctagtgtattgtgcctatagacacgagtacatataccactattcttgcat |
17351107 |
T |
 |
| Q |
100 |
aacaactaaagatctcatattgttcaaccattcaacaggttgagaaaatgcacatcattgggcagatattgataattgttgtgccaatggtgctatctgt |
199 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17351106 |
aacaactaaggatctcatattgttcgaccattcaacaggttgagaaaatgcacatcattgggcagatattgataattgttgtgccaatggtgctatctgt |
17351007 |
T |
 |
| Q |
200 |
catgaacctggtttggttcgcaaagattgtta |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17351006 |
catgaacctggtttggttcgcaaagattgtta |
17350975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University