View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1731_low_53 (Length: 238)
Name: NF1731_low_53
Description: NF1731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1731_low_53 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 39305822 - 39306042
Alignment:
| Q |
18 |
gggatcagccctatgcttcctttgtgtaaactcgaaaaattgtttccaagtgaaatcaggatatttcattggctcttgtcttcccagtatattttcaggt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39305822 |
gggatcagccctatgcttcctttgtgtaaactcgaaaaattgtttccaagtgaaatcaggatatttcgttggctcttgtcttcccagtatattttcaggt |
39305921 |
T |
 |
| Q |
118 |
gctctcacaattttgtctccttttggacacaaaaagaaagcaagagtctttctatccttctccttattagccaataccctatggagacaactcttgtata |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39305922 |
gctctcacaattttgtctccttttggacacaaaaagaaagcaagagtctttctatccttctccctattagccaataccctatggagacaactcttgtata |
39306021 |
T |
 |
| Q |
218 |
ctccgttagtcaatgcctatc |
238 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
39306022 |
ctccattagtcaatgcctatc |
39306042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University