View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1731_low_58 (Length: 236)
Name: NF1731_low_58
Description: NF1731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1731_low_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 2 - 182
Target Start/End: Complemental strand, 48152917 - 48152736
Alignment:
| Q |
2 |
aaattgttaagaaaaataattattaattgtaggggaactagtattcttttgtttattatccggtagagtatgtattattctaccaaactacttaaaaatt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48152917 |
aaattgttaagaaaaataattattaattgtaggggaactagtattcttttgtttattatctggtacagtatgtattattctaccaaactacttaaaaatt |
48152818 |
T |
 |
| Q |
102 |
gattgaatatcaatgatttgagtttaatgagtcgaatcgagttgttcgtaaat-aattattaaacgagtctaactcgagctt |
182 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
48152817 |
gattcaatatcaatgatttgagtttaatgagttgaatcgagttgttcgtgaataaattattaaacgagtctaactcgagctt |
48152736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University