View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1731_low_61 (Length: 231)
Name: NF1731_low_61
Description: NF1731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1731_low_61 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 7684908 - 7684689
Alignment:
| Q |
12 |
tattctcaaagcgtgttagtgtggtttggtttgcatgtatgtggagtaattggaaggcaagaaatgagaaactttttaacagcaaggagattcgcctaga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7684908 |
tattctcaaagcgtgttagtgtggtttggtttgcatgtatgtggagtcattggaaggcaagaaatgagaaactttttaacagcaaggagattcgcctaga |
7684809 |
T |
 |
| Q |
112 |
aaagatggtggaggatgtgaaaattcattcttggaactggttgaacattaagtcgaattgtattgactataacattgtgcattggtgtctgaatcctagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7684808 |
aaagatggtggaggatgtgaaaattcattcttggaactggttgaacattaagtcgaattgtattgactataacattgtgcattggtgtctgaatcctagg |
7684709 |
T |
 |
| Q |
212 |
gcgtgtcttggcgttattaa |
231 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7684708 |
gcgtgtcttggcgttattaa |
7684689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University