View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732-Insertion-23 (Length: 299)
Name: NF1732-Insertion-23
Description: NF1732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732-Insertion-23 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 29 - 299
Target Start/End: Original strand, 14545087 - 14545355
Alignment:
| Q |
29 |
ctttctttctttgtttcgctcgcacgaacacaaaaatatatttannnnnnn-attttattgaaaataaataaattaaatgcaactttattgatgttgatt |
127 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14545087 |
ctttctttctttgtttcgcttgcacgaacacaaaaatatttatattttttttattttattgaaaataaataaattaaatgcaactttattgatgttgatt |
14545186 |
T |
|
| Q |
128 |
atggttgtttcaggaaagttattgtgacatgcttgtgaagtataaatcagaccttactcgaccttttgacgaagctaaaacgtttctgaacaagatcgaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14545187 |
atggttgtttcaggaaagttattgtgacatgcttgtgaagtataaatcagaccttactcgaccttttgacgaagctacaacgtttctgaacaagatcgaa |
14545286 |
T |
|
| Q |
228 |
actcaactcagtcatctctgcactggtggtggtgctgctgctgcttcacttccaactgcttctggtttgttt |
299 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14545287 |
actcaactcagtcatctctgcac---tggtggtgctgctgctgcttcacttccaactgcttctggtttgttt |
14545355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University