View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732-Insertion-25 (Length: 190)
Name: NF1732-Insertion-25
Description: NF1732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732-Insertion-25 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 15652211 - 15652149
Alignment:
| Q |
128 |
tggtgtcaaacaaccttattatctattataactatttccaatgagtgatacagtttgtccttg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
15652211 |
tggtgtcaaacaaccttattatctattataactatttccaatgagtgagagagtttgtccttg |
15652149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 612494 - 612432
Alignment:
| Q |
128 |
tggtgtcaaacaaccttattatctattataactatttccaatgagtgatacagtttgtccttg |
190 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
612494 |
tggtgtcaaacaactttattatctattataactatttgcaatgagtgagacagtttttccttg |
612432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 6 - 40
Target Start/End: Complemental strand, 612616 - 612582
Alignment:
| Q |
6 |
cataaacgaattcaacggtatcatattcgattgag |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
612616 |
cataaacgaattcaacggtatcatattcgattgag |
612582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University