View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732-Insertion-26 (Length: 193)
Name: NF1732-Insertion-26
Description: NF1732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732-Insertion-26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 7 - 144
Target Start/End: Original strand, 7568605 - 7568742
Alignment:
| Q |
7 |
agttggatcagttattggatttttgggagcagctttgggaagtgttggaggtgtaggaggtggtggaatttttgtccctatgcttgctttgatcattggc |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7568605 |
agttggatcaattattggatttttgggagcagctttgggaagtgttggaggtgtaggaggtggtggaatttttgtccctatgcttgctttgatcattggc |
7568704 |
T |
|
| Q |
107 |
tttgatcccaagtcttctacagccatttccaagtgtaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7568705 |
tttgatcccaagtcttctacagccatttccaagtgtaa |
7568742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 23 - 130
Target Start/End: Complemental strand, 33126794 - 33126687
Alignment:
| Q |
23 |
ggatttttgggagcagctttgggaagtgttggaggtgtaggaggtggtggaatttttgtccctatgcttgctttgatcattggctttgatcccaagtctt |
122 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||||| ||||||||||| ||||||||| |||||||||| ||||||||||||| |||||||| ||||||| |
|
|
| T |
33126794 |
ggattttttggagcagcattgggaagtgtaggaggggtaggaggtggaggaatttttatccctatgctcactttgatcattggttttgatccaaagtctt |
33126695 |
T |
|
| Q |
123 |
ctacagcc |
130 |
Q |
| |
|
|||||||| |
|
|
| T |
33126694 |
ctacagcc |
33126687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 50747409 - 50747481
Alignment:
| Q |
18 |
ttattggatttttgggagcagctttgggaagtgttggaggtgtaggaggtggtggaatttttgtccctatgct |
90 |
Q |
| |
|
|||||||||||| |||||||| || |||||||||||||||||||| |||||||| || || || |||||||| |
|
|
| T |
50747409 |
ttattggattttgtggagcagcgtttggaagtgttggaggtgtaggtggtggtggcatattcgttcctatgct |
50747481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University