View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732-Insertion-27 (Length: 186)
Name: NF1732-Insertion-27
Description: NF1732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732-Insertion-27 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 4e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 4e-92
Query Start/End: Original strand, 8 - 186
Target Start/End: Complemental strand, 35393474 - 35393296
Alignment:
| Q |
8 |
ctaactatacgtgtttaattcagaatgatatgctcataaatttgtgaaagttcaatatatatatctaaacataccaaccaccacacatatatatacatta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35393474 |
ctaactatacgtgtttaattcagaatgatatgctcatcaatttgtgaaagttcaatatatatatctaaacataccaaccaccacacatatatatacatta |
35393375 |
T |
 |
| Q |
108 |
acggagaagcgaagttaaccgtgaggcattggcagctaccaacttggcctcatgccttccataagaagcttgtcaatgc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35393374 |
acggagaagcgaagttaaccgtgaggcattggcagctaccaacttggcctcatgccttcgataagaagcttgtcaatgc |
35393296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University