View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732-Insertion-32 (Length: 73)
Name: NF1732-Insertion-32
Description: NF1732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732-Insertion-32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 18151326 - 18151369
Alignment:
| Q |
18 |
ggtatattgattgaatcagaagttttttaaatcttctatatttt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18151326 |
ggtatattgattgaatcagaagttttttaaatcttttatatttt |
18151369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University