View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17320_low_3 (Length: 282)
Name: NF17320_low_3
Description: NF17320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17320_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 63 - 274
Target Start/End: Complemental strand, 13389425 - 13389211
Alignment:
| Q |
63 |
atgcaagtttttctatcacttagnnnnnnnttgttgtgacaacattttcttttgcagaaagatatgattgttcatttccttctaaagaacactcaaatac |
162 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13389425 |
atgcaagtttttctatcactttgcaaaaaattgttgtgacaacattttcttttgcagaaagatatgattgttcatttccttccaaagaacactcaaatac |
13389326 |
T |
|
| Q |
163 |
aagtcggtcaaatcaaatgaagctaagatcgacttttagtatcccctcctaagataacaaattgggtgatatg--gtcataaat-attaaatatgcaaac |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
13389325 |
aagtcggtcaaatcaaatgaagctaagatcgacttttagtatcacctcctaagctaacaaattgggtgatatggtgtcataaataattaaatatacaaac |
13389226 |
T |
|
| Q |
260 |
atgtctgcagaataa |
274 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
13389225 |
atgtctgctgaataa |
13389211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 17 - 56
Target Start/End: Complemental strand, 13389448 - 13389409
Alignment:
| Q |
17 |
actttttaatgtaaagtttttctatgcaagtttttctatc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13389448 |
actttttaatgtaaagtttttctatgcaagtttttctatc |
13389409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University