View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17321_low_11 (Length: 244)
Name: NF17321_low_11
Description: NF17321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17321_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 112 - 226
Target Start/End: Original strand, 10253082 - 10253197
Alignment:
| Q |
112 |
agtcattcaatgtgttactatagaagttcttggagaatgactatagaaaaagttaaacaatttgagggactgagaggggagnnnnnnngagtgca-gggg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
10253082 |
agtcattcaatgtgttactatagaagttcttggagaatgactatggaaaaagttaaacaatttgagggagtgagaggggagaaaaaaagagtgcaggggg |
10253181 |
T |
|
| Q |
211 |
atgatcgttcaatata |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10253182 |
atgatcgttcaatata |
10253197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 12 - 67
Target Start/End: Original strand, 10252982 - 10253037
Alignment:
| Q |
12 |
gagatgaaagggagctagtgaggagggttgaaatgttgagggtagtgggaggagat |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10252982 |
gagatgaaagggagctagtgaggagggttgaaatgttgagggtagtgggaggagat |
10253037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University