View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17321_low_16 (Length: 228)
Name: NF17321_low_16
Description: NF17321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17321_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 49 - 194
Target Start/End: Complemental strand, 10253589 - 10253444
Alignment:
| Q |
49 |
atcatctctcagaagaaatgaaaatttgtcctgtggggttttcaacaacaactgccatgcccgataaaattcgggtaacgaataannnnnnnnattaaaa |
148 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
10253589 |
atcatctcttagaacaaatgaaaatttgtcctgtggggttttcaacaacaaccgccatgcccgataaaattagggtaacgaataattttttctattaaaa |
10253490 |
T |
 |
| Q |
149 |
ttttaagggaacctaatgtgtggaaactaaaaattcatattgtgaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10253489 |
ttttaagggaacctaatgtgtggaaactaaaaattcatattgtgaa |
10253444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University