View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17322_low_6 (Length: 232)
Name: NF17322_low_6
Description: NF17322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17322_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 42881725 - 42881580
Alignment:
| Q |
1 |
tacaaggttcttaatatggtcatttatgatgtttttcaaactatatgggcgatggttgtgttatt----ggtgacttccatagatttggatttcgtacga |
96 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
42881725 |
tacaaggttcttaatatgatcatttatgatgtttttcaaactatatgggcgatggttgtgttattggtgggtgactttcataaatttggatttcgtacga |
42881626 |
T |
 |
| Q |
97 |
aaaactatttctctattttc-ttttttcggtcaaaagtgtttgttt |
141 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
42881625 |
aaaactatttctctattttctttttttcgttcaaaagtgtttgttt |
42881580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 169 - 203
Target Start/End: Complemental strand, 42881589 - 42881555
Alignment:
| Q |
169 |
gtgtttgtttacttgaaatacttcgtagccaattt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42881589 |
gtgtttgtttacttgaaatacttcgtagccaattt |
42881555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University