View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17324_high_11 (Length: 242)
Name: NF17324_high_11
Description: NF17324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17324_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 118 - 234
Target Start/End: Complemental strand, 43500784 - 43500668
Alignment:
| Q |
118 |
ttcgttgaatttggatcccatacagttgttgcacggtgcagaagttgtatgatagtcggagcacagaaaaacttacgactcagtcacacaagaactgaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43500784 |
ttcgttgaatttggatcccatacagttgttgcacggtgcagaagttgtataatagtcggagcacagaaaaacttacgactcagtcacacaagaactgaag |
43500685 |
T |
 |
| Q |
218 |
aactcgtacagtattat |
234 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
43500684 |
aactcgtacaatattat |
43500668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 67 - 164
Target Start/End: Complemental strand, 35131187 - 35131090
Alignment:
| Q |
67 |
gctcctttggagtgacgaataggatcaagcgcatcatctaaccatcttctcttcgttgaatttggatcccatacagttgttgcacggtgcagaagttg |
164 |
Q |
| |
|
||||||||||||||||| | ||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||| | ||||| |||||||||||| |
|
|
| T |
35131187 |
gctcctttggagtgacggagaggatcaagtgcatcatctaaccatcttctcttcgttggatttggatcccctacagccgctgcacagtgcagaagttg |
35131090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University